Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03389

HP ID(1) HP03389
Gene ID(2) 55737
Gene Symbol finder VPS35
Protein Name vacuolar protein sorting 35 homolog (S. cerevisiae)
RefSeq NM_018206.4
Length of RefSeq (bp) 3298
Chromosome 16q12
Reference DDBJ accession
UniGene Hs.454528

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14F04 pKA1U5 GGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAGTCCCCTCAGGATGA
ARe20B11 pKA1U5 GGGGTAGATCNCCATCCCATACAACACANTCAGTTCCCCNTCNNNNCATCCAGTCANGCA
ARe44B12 pKA1U5 GGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGC
ARe82F06 pKA1U5 GGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGC
ARi59F05 pGCAP10 GGTCGCCATGGTGAGTGCTGAGGGGGCAGTGGCACCTGGGTCGACCCTCCTTGTAGCCCC
RBb46C07 pGCAP1
RBd24D10 pGCAP10 GGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAGTCCCC
RBdS070J11 pGCAP10 GGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAG
RBdS083L13 pGCAP10 GACCGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl