Prev. |  KEGG KO K18468 > 

RIKEN DNA Bank Human Resource - VPS35

Gene ID NCBI Gene 55737 |  KEGG hsa:55737
Gene Symbol VPS35
Protein Name VPS35 retromer complex component
Synonyms MEM3|PARK17
Ortholog resources KEGG ortholog (KEGG orthology K18468) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030100 IRAK075E04 pBluescriptR BC041367 NM_018206 Partial/var
HGY082007 IRAL005A07 pOTB7 BC002414 NM_018206 Full
HGY087798 IRAL019I06 pDNR-LIB BC010362 NM_018206 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045724 ARe14F04 pKA1U5 NM_018206.4  
GGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAGTCCCCTCAGGATGA
HKR048035 ARe20B11 pKA1U5 NM_018206.4  
GGGGTAGATCNCCATCCCATACAACACANTCAGTTCCCCNTCNNNNCATCCAGTCANGCA
HKR057636 ARe44B12 pKA1U5 NM_018206.4  
GGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGC
HKR072926 ARe82F06 pKA1U5 NM_018206.4  
GGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGC
HKR183725 ARi59F05 pGCAP10 NM_018206.4  
GGTCGCCATGGTGAGTGCTGAGGGGGCAGTGGCACCTGGGTCGACCCTCCTTGTAGCCCC
HKR338455 RBb46C07 pGCAP1 NM_018206.4  
HKR369682 RBd24D10 pGCAP10 NM_018206.4  
GGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAGTCCCC
HKR428227 RBdS070J11 pGCAP10 NM_018206.4  
GGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAG
HKR433477 RBdS083L13 pGCAP10 NM_018206.4  
GACCGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl