Prev. | Human A to Z list > V > 

RIKEN DNA Bank Human Resource - VPS35

Gene ID (NCBI) 55737
Gene Symbol VPS35
Protein Name vacuolar protein sorting 35 homolog (S. cerevisiae)
Synonyms MEM3|PARK17
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY030100 IRAK075E04 pBluescriptR BC041367 NM_018206 Partial/var
HGY082007 IRAL005A07 pOTB7 BC002414 NM_018206 Full
HGY087798 IRAL019I06 pDNR-LIB BC010362 NM_018206 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045724 ARe14F04 pKA1U5 NM_018206.4  
GGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAGTCCCCTCAGGATGA
HKR048035 ARe20B11 pKA1U5 NM_018206.4  
GGGGTAGATCNCCATCCCATACAACACANTCAGTTCCCCNTCNNNNCATCCAGTCANGCA
HKR057636 ARe44B12 pKA1U5 NM_018206.4  
GGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGC
HKR183725 ARi59F05 pGCAP10 NM_018206.4  
GGTCGCCATGGTGAGTGCTGAGGGGGCAGTGGCACCTGGGTCGACCCTCCTTGTAGCCCC
HKR072926 ARe82F06 pKA1U5 NM_018206.4  
GGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGC
HKR369682 RBd24D10 pGCAP10 NM_018206.4  
GGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAGTCCCC
HKR338455 RBb46C07 pGCAP1 NM_018206.4  
HKR428227 RBdS070J11 pGCAP10 NM_018206.4  
GGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCATGCCTACAACACAGCAG
HKR433477 RBdS083L13 pGCAP10 NM_018206.4  
GACCGCGGGAGGCTACGCGCGGGGCGGGTGCTGCTTGCTGCAGGCTCTGGGGAGTCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl