Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03313

HP ID(1) HP03313
Gene ID(2) 9948
Gene Symbol finder WDR1
Protein Name WD repeat domain 1
RefSeq NM_017491.3
Length of RefSeq (bp) 3160
Chromosome 4p16.1
Reference DDBJ accession
UniGene Hs.128548

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04G11 pKA1U5 ATCCTGGAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCG
ARe33D01 pKA1U5 GACTCCACTCCCGGCACGCCCGGTGCCGCCTNCCCNTATNCAGNTCCCCCGGCTCGGCCT
ARe48B07 pKA1U5 GAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
ARe51F10 pKA1U5 GCGGCCTCGGACCGCCCACTCCACTCCCGGCACGCCCGGTGCCGCCTTCCGGCTCCAGTC
ARe79G02 pKA1U5 GACGCCCGGTGCCGCCTTCCGGCTCCAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTC
ARe88D07 pKA1U5 GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
ARi06C07 pGCAP10 NGAGTCCCCGGGCTCCGGCCTCGGCGNAAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGA
ARi43F03 pGCAP10 GATTCCGNTCCCCGAGGNCCCGGTGCCGCCTTCCGGCTCCNNTCCCCCGGCTCGGCCTCA
ARi46E08 pGCAP10 GCCTTCCGGCTCCAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCG
ARi61B05 pGCAP10 GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
ARiS013G04 pGCAP10 GGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGT
ARiS049K21 pGCAP10 GAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
ARiS088C13 pGCAP10 GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
ARiS118J08 pGCAP10 GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
ARiS150H14 pGCAP10 GGGGAGGGGCNCGAGNTNNCCTCTGAGCCCCGGCCTCGGACCGCCCACTCCACTCCCGGC
RBb15H12 pKA1U5 TTGCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCTC
RBd03A10 pGCAP10 GGCCGCCTTCCGGCTCCAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGG
RBd92G07 pGCAP10 GGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGT
RBdS110M16 pGCAP10 GAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl