Prev. | 

RIKEN DNA Bank Human Resource - WDR1

Gene ID NCBI Gene 9948 |  KEGG hsa:9948
Gene Symbol WDR1
Protein Name WD repeat domain 1
Synonyms AIP1|HEL-S-52|NORI-1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025622 IRAK064A22 pCMV-SPORT6 BC030541 NM_005112 Full
HGY081623 IRAL004A23 pOTB7 BC002489 NM_017491 Full
HGY082649 IRAL006K09 pOTB7 BC000201 NM_017491 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100031 M01C050B07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100079 M01C050D07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100127 M01C050F07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100175 M01C050H07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100223 M01C050J07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100271 M01C050L07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100319 M01C050N07 pDONR221 MGC14-G04 BC002489 ENST00000264785  
HGE100367 M01C050P07 pDONR221 MGC14-G04 BC002489 ENST00000264785  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041755 ARe04G11 pKA1U5 NM_017491.3  
ATCCTGGAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCG
HKR053273 ARe33D01 pKA1U5 NM_017491.3  
GACTCCACTCCCGGCACGCCCGGTGCCGCCTNCCCNTATNCAGNTCCCCCGGCTCGGCCT
HKR059231 ARe48B07 pKA1U5 NM_017491.3  
GAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
HKR060530 ARe51F10 pKA1U5 NM_017491.3  
GCGGCCTCGGACCGCCCACTCCACTCCCGGCACGCCCGGTGCCGCCTTCCGGCTCCAGTC
HKR071746 ARe79G02 pKA1U5 NM_017491.3  
GACGCCCGGTGCCGCCTTCCGGCTCCAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTC
HKR075279 ARe88D07 pKA1U5 NM_017491.3  
GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
HKR162455 ARi06C07 pGCAP10 NM_017491.3  
NGAGTCCCCGGGCTCCGGCCTCGGCGNAAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGA
HKR177323 ARi43F03 pGCAP10 NM_017491.3  
GATTCCGNTCCCCGAGGNCCCGGTGCCGCCTTCCGGCTCCNNTCCCCCGGCTCGGCCTCA
HKR178504 ARi46E08 pGCAP10 NM_017491.3  
GCCTTCCGGCTCCAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCG
HKR184429 ARi61B05 pGCAP10 NM_017491.3  
GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
HKR205348 ARiS013G04 pGCAP10 NM_017491.3  
GGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGT
HKR219861 ARiS049K21 pGCAP10 NM_017491.3  
GAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
HKR235261 ARiS088C13 pGCAP10 NM_017491.3  
GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
HKR247424 ARiS118J08 pGCAP10 NM_017491.3  
GAGTCCCCGGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCT
HKR260182 ARiS150H14 pGCAP10 NM_017491.3  
GGGGAGGGGCNCGAGNTNNCCTCTGAGCCCCGGCCTCGGACCGCCCACTCCACTCCCGGC
HKR326180 RBb15H12 pKA1U5 NM_017491.3  
TTGCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCTC
HKR361210 RBd03A10 pGCAP10 NM_017491.3  
GGCCGCCTTCCGGCTCCAGTCCCCCGGCTCGGCCTCGGCGAGGTGTAATTCGCAGCGCGG
HKR396951 RBd92G07 pGCAP10 NM_017491.3  
GGTAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGT
HKR444304 RBdS110M16 pGCAP10 NM_017491.3  
GAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl