Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110M16

Clone ID RBdS110M16
HP ID HP03313
Gene ID 9948
Gene Symbol WDR1
Protein Name WD repeat domain 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017491.3
Length of RefSeq (bp) 3160
Chromosome 4p16.1
Reference DDBJ accession
UniGene Hs.128548
5'-terminal sequence GAATTCGCAGCGCGGGCCGGCCCCGGAGGCTCTCGGCGAGCGCGGCGCGGTAACAAGTGG
2011.08.28