Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03266

HP ID(1) HP03266
Gene ID(2) 51109
Gene Symbol finder RDH11
Protein Name retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
RefSeq NM_016026.3
Length of RefSeq (bp) 2587
Chromosome 14q24.1
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe89C07 pKA1U5 GATATAGTCGGCGAGCAACGCTGGAGCATCCCGCTCTGGTGCCGCTGCAGCCGGCAGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl