Prev. |  KEGG KO K11152 > 

RIKEN DNA Bank Human Resource - RDH11

Gene ID NCBI Gene 51109 |  KEGG hsa:51109
Gene Symbol RDH11
Protein Name retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Synonyms ARSDR1|CGI82|HCBP12|MDT1|PSDR1|RALR1|RDJCSS|SCALD|SDR7C1
Ortholog resources KEGG ortholog (KEGG orthology K11152) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018927 IRAK047F07 pBluescriptR BC037302 NM_016026 Full/var
HGY083011 IRAL007I19 pOTB7 BC000112 NM_016026 Full/var
HGY091135 IRAL027N23 pOTB7 BC011727 NM_016026 Full/var
HGY094111 IRAL035E15 pDNR-LIB BC026274 NM_016026 Full/var
HGY098810 IRAL047A10 pOTB7 BC051291 NM_016026 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005708 W01A014E12 pENTR-TOPO IRAL035E15 BC026274 NM_016026  
HGE005710 W01A014E14 pENTR-TOPO IRAL035E15 BC026274 NM_016026  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075655 ARe89C07 pKA1U5 NM_016026.3  
GATATAGTCGGCGAGCAACGCTGGAGCATCCCGCTCTGGTGCCGCTGCAGCCGGCAGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl