Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03187

HP ID(1) HP03187
Gene ID(2) 573
Gene Symbol finder BAG1
Protein Name BCL2-associated athanogene
RefSeq NM_004323.4
Length of RefSeq (bp) 3885
Chromosome 9p12
Reference DDBJ accession
UniGene Hs.377484

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS045E15 pGCAP10 GGCGGGCCTGGCTCAGCGCGGGGGGGCGCGGAGACCGCGAGGCGACCGGGAGCGGCTGGG
RBb17H03 pKA1U5 GGAGGCGACCGGGAGCGGCTGGGTTCCCGGCTGCTCGCCCTTCGGCCAGGCCGGGAGCCG
RBdS075K12 pGCAP10 GGCTTCCATCGCTGGGCGGTCAACAAGTGCGGGCCTGGCTCAGCGCGGGGGGGCGCGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl