Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075K12

Clone ID RBdS075K12
HP ID HP03187
Gene ID 573
Gene Symbol BAG1
Protein Name BCL2-associated athanogene
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_004323.4
Length of RefSeq (bp) 3885
Chromosome 9p12
Reference DDBJ accession
UniGene Hs.377484
5'-terminal sequence GGCTTCCATCGCTGGGCGGTCAACAAGTGCGGGCCTGGCTCAGCGCGGGGGGGCGCGGAG
2011.08.28