Prev. |  KEGG KO K09555 > 

RIKEN DNA Bank Human Resource - BAG1

Gene ID NCBI Gene 573 |  KEGG hsa:573
Gene Symbol BAG1
Protein Name BAG cochaperone 1
Synonyms BAG-1|HAP|RAP46
Ortholog resource in our bank

  BAG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03606 pAxCALNLhBAG1 (forward) Shuttle vector to generate rAd harboring human BAG1 (forward)
RDB04172 pAxCALNLhBAG1 (reverse) Shuttle vector to generate rAd harboring human BAG1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007919 IRAK019N07 pCMV-SPORT6 BC014774 NM_004323 Partial
HGY083612 IRAL009A12 pOTB7 BC001936 NM_004323 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014642 W01A036K02 pENTR-TOPO IRAL009A12 BC001936 NM_004323  
HGE014644 W01A036K04 pENTR-TOPO IRAL009A12 BC001936 NM_004323  
HGE014646 W01A036K06 pENTR-TOPO IRAL009A12 BC001936 NM_004323  
HGE014648 W01A036K08 pENTR-TOPO IRAL009A12 BC001936 NM_004323  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218111 ARiS045E15 pGCAP10 NM_004323.4  
GGCGGGCCTGGCTCAGCGCGGGGGGGCGCGGAGACCGCGAGGCGACCGGGAGCGGCTGGG
HKR326971 RBb17H03 pKA1U5 NM_004323.4  
GGAGGCGACCGGGAGCGGCTGGGTTCCCGGCTGCTCGCCCTTCGGCCAGGCCGGGAGCCG
HKR430252 RBdS075K12 pGCAP10 NM_004323.4  
GGCTTCCATCGCTGGGCGGTCAACAAGTGCGGGCCTGGCTCAGCGCGGGGGGGCGCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl