Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03139

HP ID(1) HP03139
Gene ID(2) 9559
Gene Symbol finder VPS26A
Protein Name vacuolar protein sorting 26 homolog A (S. pombe)
RefSeq NM_004896.3
Length of RefSeq (bp) 2707
Chromosome 10q21.1
Reference DDBJ accession
UniGene Hs.499925

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe48A05 pKA1U5 GGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGGACGCNAGCANCNNCA
ARe51D07 pKA1U5 TGACNTGACGGAGCGCCGGAGCGGATGGAGCCGGGGCTGGGAGTTCTCCTGAGGGAAGAG
ARe78B10 pKA1U5 GAGGTCACGTGACGGAGCGCCGGAGCGGAGGGAGCCGGGGCTGGGAGTTCTCCTGAGGGA
ARiS020A18 pGCAP10 GGGAGCGGAGGGAGCCGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGG
ARiS150I12 pGCAP10 GCTGAGGGAAGAGGAGTGGAGTAGGGGGGACGCGGCGGCGGCGTTGACAATGAGTTTTCT
ARiS161P12 pGCAP10 GGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGGACGCNACNNNNNNNN
RBd89C03 pGCAP10 GGGAGCGGAGGGAGCCGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGG
RBd92C07 pGCAP10 GAGAGGAGTGGAGTAGGGGGGACGCGGCGGCGGCGTTGACAATGAGTTTTCTTGGAGGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl