Prev. | Human A to Z list > V > 

RIKEN DNA Bank Human Resource - VPS26A

Gene ID (NCBI) 9559
Gene Symbol VPS26A
Protein Name VPS26, retromer complex component A
Synonyms HB58|Hbeta58|PEP8A|VPS26
Databases KEGG hsa:9559 |  NCBI Gene 9559
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18466)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY012987 IRAK032H19 pBluescriptR BC022505 NM_004896 Full

(1) Please refer Vector Information and Library Method Overviews at MGC.
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005791 W01A014H23 pENTR-TOPO IRAK032H19 BC022505 NM_004896  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059205 ARe48A05 pKA1U5 NM_004896.3  
GGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGGACGCNAGCANCNNCA
HKR060479 ARe51D07 pKA1U5 NM_004896.3  
TGACNTGACGGAGCGCCGGAGCGGATGGAGCCGGGGCTGGGAGTTCTCCTGAGGGAAGAG
HKR071234 ARe78B10 pKA1U5 NM_004896.3  
GAGGTCACGTGACGGAGCGCCGGAGCGGAGGGAGCCGGGGCTGGGAGTTCTCCTGAGGGA
HKR208018 ARiS020A18 pGCAP10 NM_004896.3  
GGGAGCGGAGGGAGCCGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGG
HKR260204 ARiS150I12 pGCAP10 NM_004896.3  
GCTGAGGGAAGAGGAGTGGAGTAGGGGGGACGCGGCGGCGGCGTTGACAATGAGTTTTCT
HKR264772 ARiS161P12 pGCAP10 NM_004896.3  
GGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGGACGCNACNNNNNNNN
HKR395651 RBd89C03 pGCAP10 NM_004896.3  
GGGAGCGGAGGGAGCCGGGGCTGGGAGTTCTCCTGAGGGAAGAGGAGTGGAGTAGGGGGG
HKR396855 RBd92C07 pGCAP10 NM_004896.3  
GAGAGGAGTGGAGTAGGGGGGACGCGGCGGCGGCGTTGACAATGAGTTTTCTTGGAGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.10.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl