Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03119

HP ID(1) HP03119
Gene ID(2) 10493
Gene Symbol finder VAT1
Protein Name vesicle amine transport protein 1 homolog (T. californica)
RefSeq NM_006373.3
Length of RefSeq (bp) 2758
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.514199

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS150F08 pGCAP10 GCCCGACGCGTTCCGCCTTCCCCAGCTGTGCACTCTCCATCCAGCTGTGCGCTCTCGTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl