Prev. |  KEGG KO K23167 > 

RIKEN DNA Bank Human Resource - VAT1

Gene ID NCBI Gene 10493 |  KEGG hsa:10493
Gene Symbol VAT1
Protein Name vesicle amine transport 1
Synonyms VATI
Ortholog resource in our bank

  VAT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19564 pGEXM-hVAT1 Full-length(1-393) Bacterial expression vector of human VAT1 full-length (a.a. 1-393) tagged with GST at N-terminus.
RDB19565 pGEXM-hVAT1 (37-393) Bacterial expression vector of human VAT1 mutant (a.a 37-393 residues) tagged with GST at N-terminus.
RDB19566 pGEXM-hVAT1 (43-393) Bacterial expression vector of human VAT1 mutant (a.a 43-393 residues) tagged with GST at N-terminus.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX006276 IRAK015L12 pCMV-SPORT6 BC015041 NM_006373 Full
HGY082107 IRAL005E11 pOTB7 BC008725 NM_006373 Full
HGY083488 IRAL008L24 pOTB7 BC001913 NM_006373 Partial
HGY085643 IRAL014B19 pOTB7 BC014279 NM_006373 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006596 W01A016I04 pENTR-TOPO IRAL005E11 BC008725 NM_006373  
HGE006598 W01A016I06 pENTR-TOPO IRAL005E11 BC008725 NM_006373  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR260128 ARiS150F08 pGCAP10 NM_006373.3  
GCCCGACGCGTTCCGCCTTCCCCAGCTGTGCACTCTCCATCCAGCTGTGCGCTCTCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl