Prev. | NRCD Clone X | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03024

HP ID(1) HP03024
Gene ID(2) 7520
Gene Symbol finder XRCC5
Protein Name X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
RefSeq NM_021141.3
Length of RefSeq (bp) 3448
Chromosome 2q35
Reference DDBJ accession
UniGene Hs.388739

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe33D02 pKA1U5 GGCCCGGAAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATA
ARe39E04 pKA1U5 ATCCTGATGGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGA
ARi40B02 pGCAP10 GGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCA
ARi53E11 pGCAP10 GTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGATTTGCCACACGGGGGGTTCCCGC
ARiS085K03 pGCAP10 GACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGG
ARiS191D21 pGCAP10 GACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGC
RBb36G05 pGCAP1 GCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGNTGCGGTCGGGGA
RBb68G11 pGCAP1 GAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCA
RBd39C02 pGCAP10 GGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGC
RBd89B03 pGCAP10 GGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCG
RBdS007P12 pGCAP10 GGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTA
RBdS040H18 pGCAP10 GGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAA
RBdS156P18 pGCAP10 GGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl