Prev. |  KEGG KO K10885 > 

RIKEN DNA Bank Human Resource - XRCC5

Gene ID NCBI Gene 7520 |  KEGG hsa:7520
Gene Symbol XRCC5
Protein Name X-ray repair cross complementing 5
Synonyms KARP-1|KARP1|KU80|KUB2|Ku86|NFIV
Ortholog resource in our bank

  XRCC5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17382 Ku80 px330 Expression vector of guide RNA for targeting human Ku80/XRCC5 exon 6.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092181 IRAL030H13 pOTB7 BC019027 NM_021141 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053274 ARe33D02 pKA1U5 NM_021141.3  
GGCCCGGAAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATA
HKR055700 ARe39E04 pKA1U5 NM_021141.3  
ATCCTGATGGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGA
HKR176026 ARi40B02 pGCAP10 NM_021141.3  
GGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCA
HKR181307 ARi53E11 pGCAP10 NM_021141.3  
GTCTTTCCGCTATCTGCCGCTTGTCCACCGGAAGCGATTTGCCACACGGGGGGTTCCCGC
HKR234243 ARiS085K03 pGCAP10 NM_021141.3  
GACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGG
HKR276493 ARiS191D21 pGCAP10 NM_021141.3  
GACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGC
HKR334549 RBb36G05 pGCAP1 NM_021141.3  
GCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGNTGCGGTCGGGGA
HKR347355 RBb68G11 pGCAP1 NM_021141.3  
GAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCA
HKR375650 RBd39C02 pGCAP10 NM_021141.3  
GGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGC
HKR395627 RBd89B03 pGCAP10 NM_021141.3  
GGTCCACCGGAAGCGAGTTGCGACACGGCAGGTTCCCGCCCGGAAGAAGCGACCAAAGCG
HKR403172 RBdS007P12 pGCAP10 NM_021141.3  
GGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATGGACGTGGGCTTTACCATGAGTA
HKR416186 RBdS040H18 pGCAP10 NM_021141.3  
GGCCCGGAAGAAGCGACCAAAGCGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAA
HKR462778 RBdS156P18 pGCAP10 NM_021141.3  
GGCCTGAGGACCGGCAACATGGTGCGGTCGGGGAATAAGGCAGCTGTTGTGCTGTGTATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl