Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02992

HP ID(1) HP02992
Gene ID(2) 9260
Gene Symbol finder PDLIM7
Protein Name PDZ and LIM domain 7 (enigma)
RefSeq NM_005451.3
Length of RefSeq (bp) 1709
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.533040

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS088L23 pGCAP10 GGTCAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGC
ARiS096P05 pGCAP10 GGTCAGAACNCTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCANCGC
RBdS154F09 pGCAP10 GAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGCCCT
RBdS177F11 pGCAP10 GGTCAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl