Prev. | 

RIKEN DNA Bank Human Resource - PDLIM7

Gene ID NCBI Gene 9260 |  KEGG hsa:9260
Gene Symbol PDLIM7
Protein Name PDZ and LIM domain 7
Synonyms LMP1|LMP3
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082854 IRAL007C06 pOTB7 BC001093 NM_005451 Full
HGY103966 IRAL059P06 pOTB7 BC084575 NM_005451 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235487 ARiS088L23 pGCAP10 NM_005451.3  
GGTCAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGC
HKR238765 ARiS096P05 pGCAP10 NM_005451.3  
GGTCAGAACNCTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCANCGC
HKR461729 RBdS154F09 pGCAP10 NM_005451.3  
GAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGCCCT
HKR470931 RBdS177F11 pGCAP10 NM_005451.3  
GGTCAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl