Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177F11

Clone ID RBdS177F11
HP ID HP02992
Gene ID 9260
Gene Symbol PDLIM7
Protein Name PDZ and LIM domain 7 (enigma)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_005451.3
Length of RefSeq (bp) 1709
Chromosome 5q35.3
Reference DDBJ accession
UniGene Hs.533040
5'-terminal sequence GGTCAGAACACTGGCGGCCGATCCCAACGAGGCTCCCTGGAGCCCGACGCAGAGCAGCGC
2011.08.28