Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02981

HP ID(1) HP02981
Gene ID(2) 5531
Gene Symbol finder PPP4C
Protein Name protein phosphatase 4 (formerly X), catalytic subunit
RefSeq NM_002720.1
Length of RefSeq (bp) 1429
Chromosome 16p12-p11
Reference DDBJ accession
UniGene Hs.534338

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe56F10 pKA1U5 GGCCGGAAGTAGGAGCGGCGGCGGCGGCGGCGCCCGGNNGTCGAAAGCGGAGTGAAAGAG
ARi49A06 pGCAP10 GGGAAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAG
RBd90C05 pGCAP10 GGGAAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAG
RBdS177C20 pGCAP10 GAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl