Prev. |  KEGG KO K15423 > 

RIKEN DNA Bank Human Resource - PPP4C

Gene ID NCBI Gene 5531 |  KEGG hsa:5531
Gene Symbol PPP4C
Protein Name protein phosphatase 4 catalytic subunit
Synonyms PP-X|PP4|PP4C|PPH3|PPP4|PPX
Ortholog resource in our bank

  PPP4C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081812 IRAL004I20 pOTB7 BC001416 NM_002720 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014086 W01A035D14 pENTR-TOPO IRAL004I20 BC001416 NM_002720  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062530 ARe56F10 pKA1U5 NM_002720.1  
GGCCGGAAGTAGGAGCGGCGGCGGCGGCGGCGCCCGGNNGTCGAAAGCGGAGTGAAAGAG
HKR179606 ARi49A06 pGCAP10 NM_002720.1  
GGGAAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAG
HKR396053 RBd90C05 pGCAP10 NM_002720.1  
GGGAAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAG
HKR470868 RBdS177C20 pGCAP10 NM_002720.1  
GAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl