Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177C20

Clone ID RBdS177C20
HP ID HP02981
Gene ID 5531
Gene Symbol PPP4C
Protein Name protein phosphatase 4 (formerly X), catalytic subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002720.1
Length of RefSeq (bp) 1429
Chromosome 16p12-p11
Reference DDBJ accession
UniGene Hs.534338
5'-terminal sequence GAGTAGGAGCGGCGGCGGCGGCGGCGGCGGCGGTCGAAAGCGGAGTGAAAGAGGGAGGCA
2011.08.28