Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02923

HP ID(1) HP02923
Gene ID(2) 388
Gene Symbol finder RHOB
Protein Name ras homolog gene family, member B
RefSeq NM_004040.2
Length of RefSeq (bp) 2384
Chromosome 2p24
Reference DDBJ accession
UniGene Hs.502876

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb63G03 pGCAP1 TATCTGCCACCGCAGTCTGGTTGGAGCTGTTGTCTTGTATGCTCAGCGAGGCCCGGAGAG
RBd55B03 pGCAP10 GATCTGCCACCGCAGTCTGGTTGGAGCTGTTGTCTTGTATNCNNNNNNNNNGCCCGGAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl