Prev. |  KEGG KO K07856 > 

RIKEN DNA Bank Human Resource - RHOB

Gene ID NCBI Gene 388 |  KEGG hsa:388
Gene Symbol RHOB
Protein Name ras homolog family member B
Synonyms ARH6|ARHB|MST081|MSTP081|RHOH6
Ortholog resource in our bank

  RHOB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13356 pYNL-C1_RhoB Yellow Nano-lantern for labeling of plasma membrane and endosomes by the human RhoB.
RDB13357 pCNL-C1_RhoB Cyan Nano-lantern for labeling of plasma membrane and endosomes by the human RhoB.
RDB13358 pONL-C1_RhoB Orange Nano-lantern for labeling of plasma membrane and endosomes by the human RhoB.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067045 IRAK167K05 pBluescriptR BC066954 NM_004040 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE083217 M01C008A17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083265 M01C008C17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083313 M01C008E17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083361 M01C008G17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083409 M01C008I17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083457 M01C008K17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083505 M01C008M17 pDONR221 FLJ01-E09 AK124398 NM_004040  
HGE083553 M01C008O17 pDONR221 FLJ01-E09 AK124398 NM_004040  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR345347 RBb63G03 pGCAP1 NM_004040.2  
TATCTGCCACCGCAGTCTGGTTGGAGCTGTTGTCTTGTATGCTCAGCGAGGCCCGGAGAG
HKR382027 RBd55B03 pGCAP10 NM_004040.2  
GATCTGCCACCGCAGTCTGGTTGGAGCTGTTGTCTTGTATNCNNNNNNNNNGCCCGGAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.07.13

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl