Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02876

HP ID(1) HP02876
Gene ID(2) 8131
Gene Symbol finder C16orf35
Protein Name chromosome 16 open reading frame 35
RefSeq NM_001039476.1
Length of RefSeq (bp) 2753
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.19699

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd40C07 pGCAP10 GAGTCTCGCGAGCCCGGAGCGTGGCACGTGGGTTGGTAACTGTGGCGCTGCTCCCTCCAC
RBd81F02 pGCAP10 GCCCTCCGCCTCCGGCTCCGTCCTCCTCAGGCCCCCTCCGCCTCCGGCTCCGTCCTCCTC
RBdS110B20 pGCAP10 GGGGTTGGTAACTGTGGCGCTGCTCCCTCCACCACCACCCCTGTCCTCCTCAGGNCCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl