Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NPRL3

Gene ID (NCBI) 8131
Gene Symbol NPRL3
Protein Name nitrogen permease regulator-like 3 (S. cerevisiae)
Synonyms C16orf35|CGTHBA|HS-40|MARE|NPR3|RMD11
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080890 IRAL002D18 pOTB7 BC004185 NM_001039476 Full
HGY084183 IRAL010H15 pOTB7 BC012825 NM_001039476 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR376055 RBd40C07 pGCAP10 NM_001039476.1
GAGTCTCGCGAGCCCGGAGCGTGGCACGTGGGTTGGTAACTGTGGCGCTGCTCCCTCCAC
HKR392522 RBd81F02 pGCAP10 NM_001039476.1
GCCCTCCGCCTCCGGCTCCGTCCTCCTCAGGCCCCCTCCGCCTCCGGCTCCGTCCTCCTC
HKR444044 RBdS110B20 pGCAP10 NM_001039476.1
GGGGTTGGTAACTGTGGCGCTGCTCCCTCCACCACCACCCCTGTCCTCCTCAGGNCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl