Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110B20

Clone ID RBdS110B20
HP ID HP02876
Gene ID 8131
Gene Symbol C16orf35
Protein Name chromosome 16 open reading frame 35
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001039476.1
Length of RefSeq (bp) 2753
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.19699
5'-terminal sequence GGGGTTGGTAACTGTGGCGCTGCTCCCTCCACCACCACCCCTGTCCTCCTCAGGNCCTCT
2011.08.28