Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02635

HP ID(1) HP02635
Gene ID(2) 6119
Gene Symbol finder RPA3
Protein Name replication protein A3, 14kDa
RefSeq NM_002947.3
Length of RefSeq (bp) 1613
Chromosome 7p22
Reference DDBJ accession
UniGene Hs.487540

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi37H05 pGCAP10 GAGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGACATGAT
ARiS088G15 pGCAP10 GAGTCTTGGACCATAATCATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCC
ARiS191F05 pGCAP10 GGTTTCAGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGAC
RBb05H12 pKA1U5 GAGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGACATGAT
RBd16C08 pGCAP10 TGGCAGTCTTGGACCATAATCATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAAC
RBdS014B07 pGCAP10 GAGTCTTGGACCATAATCATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl