Prev. |  KEGG KO K10740 > 

RIKEN DNA Bank Human Resource - RPA3

Gene ID NCBI Gene 6119 |  KEGG hsa:6119
Gene Symbol RPA3
Protein Name replication protein A3
Synonyms REPA3|RP-A p14
Featured content DNA repair (human)
Ortholog resource in our bank

  RPA3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086465 IRAL016C17 pDNR-LIB BC005264 NM_002947 Full
HGY090143 IRAL025F23 pOTB7 BC009868 NM_002947

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028038 W01A070B14 pENTR-TOPO IRAL016C17 BC005264 NM_002947  
HGE028046 W01A070B22 pENTR-TOPO IRAL016C17 BC005264 NM_002947  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174973 ARi37H05 pGCAP10 NM_002947.3  
GAGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGACATGAT
HKR235359 ARiS088G15 pGCAP10 NM_002947.3  
GAGTCTTGGACCATAATCATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCC
HKR276525 ARiS191F05 pGCAP10 NM_002947.3  
GGTTTCAGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGAC
HKR322180 RBb05H12 pKA1U5 NM_002947.3  
GAGTCGTCCGTGGGTTTCCCGCCAGCCGCAGTCTTGGACCATAATCATGGTGGACATGAT
HKR366456 RBd16C08 pGCAP10 NM_002947.3  
TGGCAGTCTTGGACCATAATCATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAAC
HKR405631 RBdS014B07 pGCAP10 NM_002947.3  
GAGTCTTGGACCATAATCATGGTGGACATGATGGACTTGCCCAGGTCGCGCATCAACGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl