Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02574

HP ID(1) HP02574
Gene ID(2) 22931
Gene Symbol finder RAB18
Protein Name RAB18, member RAS oncogene family
RefSeq NM_021252.3
Length of RefSeq (bp) 2809
Chromosome 10p12.1
Reference DDBJ accession
UniGene Hs.406799

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe16D11 pKA1U5 GACTCTGCTGAAGGGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGCGGAACGG
ARe20E12 pKA1U5 GACTCTGCTGAAGGGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGCGGAACGG
ARiS055L01 pGCAP10 GGCGGCCAGCTGGGCTCGGAGCGGAACGGGGTCAGGATGGACGAGGACGTGCTAACCACC
RBb57F02 pGCAP1 AGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGTGCAGCGGGGTTAGGATGGAC
RBd39F07 pGCAP10 GCTCGGAGCGGAACGGGGTCAGGATGGACGAGGACGTGCTAACCACCCTGAAGATCCTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl