Prev. |  KEGG KO K07910 > 

RIKEN DNA Bank Human Resource - RAB18

Gene ID NCBI Gene 22931 |  KEGG hsa:22931
Gene Symbol RAB18
Protein Name RAB18, member RAS oncogene family
Synonyms RAB18LI1|WARBM3
Featured content Rab Family - human
Ortholog resource in our bank

  RAB18

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB14699 pDEST/mCherry-Rab18 Expression vector of human Rab18, wild type, fused with mCherry.
RDB14700 pDEST/mCherry-Rab18 Q67L Expression vector of human Rab18, constitutively active GTP-binding mutant (Q67L), fused with mCherry.
RDB14701 pDEST/mCherry-Rab18 S22N Expression vector of human Rab18, dominant-negative GDP-binding mutant (S22N), fused with mCherry.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013172 IRAK032P12 pBluescriptR BC029350 NM_021252 Full
HGX006345 IRAK015O09 pCMV-SPORT6 BC015014 NM_021252

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018946 W01A047G02 pENTR-TOPO IRAK015O09 BC015014 NM_021252  
HGE018958 W01A047G14 pENTR-TOPO IRAK015O09 BC015014 NM_021252  
HGE018960 W01A047G16 pENTR-TOPO IRAK015O09 BC015014 NM_021252  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046483 ARe16D11 pKA1U5 NM_021252.3  
GACTCTGCTGAAGGGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGCGGAACGG
HKR048108 ARe20E12 pKA1U5 NM_021252.3  
GACTCTGCTGAAGGGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGCGGAACGG
HKR222265 ARiS055L01 pGCAP10 NM_021252.3  
GGCGGCCAGCTGGGCTCGGAGCGGAACGGGGTCAGGATGGACGAGGACGTGCTAACCACC
HKR342922 RBb57F02 pGCAP1 NM_021252.3  
AGCTGAGAGGCGCACCCGGGCGGCCAGCTGGGCTCGGAGTGCAGCGGGGTTAGGATGGAC
HKR375727 RBd39F07 pGCAP10 NM_021252.3  
GCTCGGAGCGGAACGGGGTCAGGATGGACGAGGACGTGCTAACCACCCTGAAGATCCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl