Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02572

HP ID(1) HP02572
Gene ID(2) 116832
Gene Symbol finder RPL39L
Protein Name ribosomal protein L39-like
RefSeq NM_052969.1
Length of RefSeq (bp) 735
Chromosome 3q27
Reference DDBJ accession
UniGene Hs.647900

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59F04 pKA1U5 GNCACTTGCNGTCTTNCNNAGCGCTTAAATNGCATNCGCNCNGGTCGAGTTGAACCGTNN
ARe62C08 pKA1U5 GGCATCCGGCGCGCGGCGGTTGAATTGCTGCGCCCAGCGAGGCAACCGCCTCCGAACGCC
ARf01H07 pKA1U5 GGCGGTCTTAGCATCCGGCGCGCGGCGGTTGAATTGCTGCGCCCAGCGAGGCAACCGCCT
ARiS122K10 pGCAP10 GGGCGGTTGAATTGCTGCNCCCANCGAGGCAACCGCCTCCGAACGCCAGGTGGGGGCGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl