Prev. | 

RIKEN DNA Bank Human Resource - RPL39L

Gene ID NCBI Gene 116832 |  KEGG hsa:116832
Gene Symbol RPL39L
Protein Name ribosomal protein L39 like
Synonyms L39-2|RPL39L1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091684 IRAL029D12 pOTB7 BC012328 NM_052969

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063724 ARe59F04 pKA1U5 NM_052969.1  
GNCACTTGCNGTCTTNCNNAGCGCTTAAATNGCATNCGCNCNGGTCGAGTTGAACCGTNN
HKR064856 ARe62C08 pKA1U5 NM_052969.1  
GGCATCCGGCGCGCGGCGGTTGAATTGCTGCGCCCAGCGAGGCAACCGCCTCCGAACGCC
HKR080575 ARf01H07 pKA1U5 NM_052969.1  
GGCGGTCTTAGCATCCGGCGCGCGGCGGTTGAATTGCTGCGCCCAGCGAGGCAACCGCCT
HKR249050 ARiS122K10 pGCAP10 NM_052969.1  
GGGCGGTTGAATTGCTGCNCCCANCGAGGCAACCGCCTCCGAACGCCAGGTGGGGGCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl