Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02531

HP ID(1) HP02531
Gene ID(2) 5573
Gene Symbol finder PRKAR1A
Protein Name protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)
RefSeq NM_002734.3
Length of RefSeq (bp) 3626
Chromosome 17q23-q24
Reference DDBJ accession
UniGene Hs.280342

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe63C07 pKA1U5 GGTTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAA
ARe79C06 pKA1U5 GAGGCCGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGA
ARi08C03 pGCAP10 GGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAAGCGCTGAGGGAGCTC
RBd19D03 pGCAP10 GGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAAGCGCTGAGG
RBd37E08 pGCAP10 GGGGGCTGGGAGCAAAGCGCTGAGGGAGCTCGGTACGCCGCCGCCTCGCACCCGCAGCCT
RBd51G11 pGCAP10 GGGCCAGGCCGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCT
RBd73H09 pGCAP10 GATCGCNNAGNGGAGCGGGGCTGGGAGCAAAGCGCTGAGGGAGCTCGGTACGCCGCCGCC
RBdS070B17 pGCAP10 GGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl