Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PRKAR1A

Gene ID (NCBI) 5573
Gene Symbol PRKAR1A
Protein Name protein kinase, cAMP-dependent, regulatory, type I, alpha
Synonyms ACRDYS1|ADOHR|CAR|CNC|CNC1|PKR1|PPNAD1|PRKAR1|TSE1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03569 pAxCALNLhPRKAR1A (forward) Shuttle vector to generate rAd harboring human PRKAR1A (forward)
RDB04140 pAxCALNLhPRKAR1A Shuttle vector to generate rAd harboring human PRKAR1A
RDB04656 pAxCALNLhPRKAR1A(forward) Shuttle vector to generate rAd expressing human PRKAR1A

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX005163 IRAK012P03 pCMV-SPORT6 BC036285 NM_212472 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001795 W01A004I03 pENTR-TOPO IRAK012P03 BC036285 NM_212472  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163251 ARi08C03 pGCAP10 NM_002734.3  
GGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAAGCGCTGAGGGAGCTC
HKR065255 ARe63C07 pKA1U5 NM_002734.3  
GGTTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAA
HKR071654 ARe79C06 pKA1U5 NM_002734.3  
GAGGCCGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGA
HKR367675 RBd19D03 pGCAP10 NM_002734.3  
GGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAAGCGCTGAGG
HKR374904 RBd37E08 pGCAP10 NM_002734.3  
GGGGGCTGGGAGCAAAGCGCTGAGGGAGCTCGGTACGCCGCCGCCTCGCACCCGCAGCCT
HKR380555 RBd51G11 pGCAP10 NM_002734.3  
GGGCCAGGCCGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCT
HKR389377 RBd73H09 pGCAP10 NM_002734.3  
GATCGCNNAGNGGAGCGGGGCTGGGAGCAAAGCGCTGAGGGAGCTCGGTACGCCGCCGCC
HKR428041 RBdS070B17 pGCAP10 NM_002734.3  
GGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.12.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl