Prev. |  KEGG KO K04739 > 

RIKEN DNA Bank Human Resource - PRKAR1A

Gene ID NCBI Gene 5573 |  KEGG hsa:5573
Gene Symbol PRKAR1A
Protein Name protein kinase cAMP-dependent type I regulatory subunit alpha
Synonyms ACRDYS1|ADOHR|CAR|CNC|CNC1|PKR1|PPNAD1|PRKAR1|TSE1
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  PRKAR1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03569 pAxCALNLhPRKAR1A (forward) Shuttle vector to generate rAd harboring human PRKAR1A (forward)
RDB04140 pAxCALNLhPRKAR1A (reverse) Shuttle vector to generate rAd harboring human PRKAR1A
RDB04656 pAxCALNLhPRKAR1A(forward) Shuttle vector to generate rAd expressing human PRKAR1A

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005163 IRAK012P03 pCMV-SPORT6 BC036285 NM_212472 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001795 W01A004I03 pENTR-TOPO IRAK012P03 BC036285 NM_212472  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065255 ARe63C07 pKA1U5 NM_002734.3  
GGTTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAA
HKR071654 ARe79C06 pKA1U5 NM_002734.3  
GAGGCCGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGA
HKR163251 ARi08C03 pGCAP10 NM_002734.3  
GGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAAGCGCTGAGGGAGCTC
HKR367675 RBd19D03 pGCAP10 NM_002734.3  
GGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAAGCGCTGAGG
HKR374904 RBd37E08 pGCAP10 NM_002734.3  
GGGGGCTGGGAGCAAAGCGCTGAGGGAGCTCGGTACGCCGCCGCCTCGCACCCGCAGCCT
HKR380555 RBd51G11 pGCAP10 NM_002734.3  
GGGCCAGGCCGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCT
HKR389377 RBd73H09 pGCAP10 NM_002734.3  
GATCGCNNAGNGGAGCGGGGCTGGGAGCAAAGCGCTGAGGGAGCTCGGTACGCCGCCGCC
HKR428041 RBdS070B17 pGCAP10 NM_002734.3  
GGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl