Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS070B17

Clone ID RBdS070B17
HP ID HP02531
Gene ID 5573
Gene Symbol PRKAR1A
Protein Name protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002734.3
Length of RefSeq (bp) 3626
Chromosome 17q23-q24
Reference DDBJ accession
UniGene Hs.280342
5'-terminal sequence GGTTTCCGGTGGAGCTGTCGCCTAGCCGCTATCGCAGAGTGGAGCGGGGCTGGGAGCAAA
2011.08.28