Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02499

HP ID(1) HP02499
Gene ID(2) 29789
Gene Symbol finder OLA1
Protein Name Obg-like ATPase 1
RefSeq NM_013341.3
Length of RefSeq (bp) 4356
Chromosome 2q31.1
Reference DDBJ accession
UniGene Hs.157351

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe29F08 pKA1U5 GCTCTTCCTCCTTCTCCGGCTGTGCCTGCTTCCTGTTTACCTTTGCCATGATTGGAAGTT
ARe31D06 pKA1U5 GACAACCGGAGTTGATATGGTTTGGATTTTTGTCTCTGCCCGAATCTCATGTTGAATTAT
ARe58H02 pKA1U5 GCTCCTTCCTCCCCGCCTCCAGCTGCCGGCAGGACCTTTCTCTCGCTGCCGCTGGGACCC
ARe60F04 pKA1U5 GACTTTTACAACCGGAGTTGATATGGTTTGGATTTTTGTCTCTGCCCGAATCTCATGTTG
ARi50H04 pGCAP10 GTCCGCCGCTGTCGCCGCCGGCGTGCGAGACGCTCGGCGGAGGGGACGGGCCTGCGTTCT
ARi59D09 pGCAP10 GNNCCGCCCGTTCCGCCGCTGTCGCCGCCGTCGTGCGTGCCGCTCGGCGGNGGNCNGNCT
ARiS020K18 pGCAP10 GGTCATCGCCCAGGCCGAGCACGATGCCCCCTAAAAAGGGAGGTGATGGAATTAAACCAC
ARiS049I24 pGCAP10 GCTCCTTCTCCGGCTGTGCCTGCTTCCTGTTTACCTTTGCCATGATTGGAAGTTTCCTGA
RBb10H03 pKA1U5 GGTCGTGCGCTGCCGCTCGGCGGAGGGGACGGGCCTGCGNTTCTCTCCTCCTTCCTCCCC
RBb52B07 pGCAP1 GGCCGTTCGTGCGATGCCGCTTCGGCGGAAGGGGAACGGGCCTGCGNTTCTCTCCTCCTT
RBb61C07 pGCAP1 GGTCGTGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGTTCTCTCCTCCTTCCTCCCCGC
RBd53A08 pGCAP10 GCTCTCCTCCTTCCTCCCCGCCTCCAGCTGCCGGCAGGACCTTTCTCTCGCTGCCGCTGG
RBd65C01 pGCAP10 GCGTTCCGCCGCTGTCGCCGCCGTCGTGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGT
RBdS083B02 pGCAP10 GGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGTTCTCTCCTCCTTCCTCCCCGCCTCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl