Prev. |  KEGG KO K19788 > 

RIKEN DNA Bank Human Resource - OLA1

Gene ID NCBI Gene 29789 |  KEGG hsa:29789
Gene Symbol OLA1
Protein Name Obg like ATPase 1
Synonyms DOC45|GBP45|GTBP9|GTPBP9|PTD004
Ortholog resources KEGG ortholog (KEGG orthology K19788) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008552 IRAK021G08 pCMV-SPORT6 BC012842 NM_013341 Full
HGY092426 IRAL031B02 pDNR-LIB BC013925 NM_013341 Partial/var
HGY096584 IRAL041H16 pDNR-LIB BC029376 NM_013341 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051728 ARe29F08 pKA1U5 NM_013341.3  
GCTCTTCCTCCTTCTCCGGCTGTGCCTGCTTCCTGTTTACCTTTGCCATGATTGGAAGTT
HKR052478 ARe31D06 pKA1U5 NM_013341.3  
GACAACCGGAGTTGATATGGTTTGGATTTTTGTCTCTGCCCGAATCTCATGTTGAATTAT
HKR063370 ARe58H02 pKA1U5 NM_013341.3  
GCTCCTTCCTCCCCGCCTCCAGCTGCCGGCAGGACCTTTCTCTCGCTGCCGCTGGGACCC
HKR064124 ARe60F04 pKA1U5 NM_013341.3  
GACTTTTACAACCGGAGTTGATATGGTTTGGATTTTTGTCTCTGCCCGAATCTCATGTTG
HKR180172 ARi50H04 pGCAP10 NM_013341.3  
GTCCGCCGCTGTCGCCGCCGGCGTGCGAGACGCTCGGCGGAGGGGACGGGCCTGCGTTCT
HKR183681 ARi59D09 pGCAP10 NM_013341.3  
GNNCCGCCCGTTCCGCCGCTGTCGCCGCCGTCGTGCGTGCCGCTCGGCGGNGGNCNGNCT
HKR208258 ARiS020K18 pGCAP10 NM_013341.3  
GGTCATCGCCCAGGCCGAGCACGATGCCCCCTAAAAAGGGAGGTGATGGAATTAAACCAC
HKR219816 ARiS049I24 pGCAP10 NM_013341.3  
GCTCCTTCTCCGGCTGTGCCTGCTTCCTGTTTACCTTTGCCATGATTGGAAGTTTCCTGA
HKR324171 RBb10H03 pKA1U5 NM_013341.3  
GGTCGTGCGCTGCCGCTCGGCGGAGGGGACGGGCCTGCGNTTCTCTCCTCCTTCCTCCCC
HKR340831 RBb52B07 pGCAP1 NM_013341.3  
GGCCGTTCGTGCGATGCCGCTTCGGCGGAAGGGGAACGGGCCTGCGNTTCTCTCCTCCTT
HKR344455 RBb61C07 pGCAP1 NM_013341.3  
GGTCGTGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGTTCTCTCCTCCTTCCTCCCCGC
HKR381208 RBd53A08 pGCAP10 NM_013341.3  
GCTCTCCTCCTTCCTCCCCGCCTCCAGCTGCCGGCAGGACCTTTCTCTCGCTGCCGCTGG
HKR386049 RBd65C01 pGCAP10 NM_013341.3  
GCGTTCCGCCGCTGTCGCCGCCGTCGTGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGT
HKR433226 RBdS083B02 pGCAP10 NM_013341.3  
GGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGTTCTCTCCTCCTTCCTCCCCGCCTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl