Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083B02

Clone ID RBdS083B02
HP ID HP02499
Gene ID 29789
Gene Symbol OLA1
Protein Name Obg-like ATPase 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_013341.3
Length of RefSeq (bp) 4356
Chromosome 2q31.1
Reference DDBJ accession
UniGene Hs.157351
5'-terminal sequence GGCGTGCCGCTCGGCGGAGGGGACGGGCCTGCGTTCTCTCCTCCTTCCTCCCCGCCTCCA
2011.08.28