Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02486

HP ID(1) HP02486
Gene ID(2) 5160
Gene Symbol finder PDHA1
Protein Name pyruvate dehydrogenase (lipoamide) alpha 1
RefSeq NM_000284.2
Length of RefSeq (bp) 3364
Chromosome Xp22.2-p22.1
Reference DDBJ accession
UniGene Hs.530331

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe64G01 pKA1U5 ATCCTGGGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCCGCGTTCGTGCCTCCTG
RBd16G05 pGCAP10 GACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTG
RBd44H10 pGCAP10 GGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTG
RBdS013I11 pGCAP10 TGGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGTGCTTCATGAGGAAGA
RBdS051P14 pGCAP10 GGTTATTACGACTCTGTCACGCCGCGGTGCGACTGAGGCGTGGCGTCTGCTGGGGCACCT
RBdS105K22 pGCAP10 GGAAGGAGACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl