Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051P14

Clone ID RBdS051P14
HP ID HP02486
Gene ID 5160
Gene Symbol PDHA1
Protein Name pyruvate dehydrogenase (lipoamide) alpha 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000284.2
Length of RefSeq (bp) 3364
Chromosome Xp22.2-p22.1
Reference DDBJ accession
UniGene Hs.530331
5'-terminal sequence GGTTATTACGACTCTGTCACGCCGCGGTGCGACTGAGGCGTGGCGTCTGCTGGGGCACCT
2011.08.28