Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PDHA1

Gene ID (NCBI) 5160
Gene Symbol PDHA1
Protein Name pyruvate dehydrogenase E1 alpha 1 subunit
Synonyms PDHA|PDHAD|PDHCE1A|PHE1A
Databases KEGG hsa:5160 |  NCBI Gene 5160
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00161)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07514 pGL4-phPDHA1 Promoter collection, Human PDHA1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080688 IRAL001L24 pOTB7 BC002406 NM_000284 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065745 ARe64G01 pKA1U5 NM_000284.2  
ATCCTGGGTCTGCTGGGGCACCTGAAGGAGACTTGGGGGCACCCGCGTTCGTGCCTCCTG
HKR366549 RBd16G05 pGCAP10 NM_000284.2  
GACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTG
HKR377778 RBd44H10 pGCAP10 NM_000284.2  
GGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTG
HKR405403 RBdS013I11 pGCAP10 NM_000284.2  
TGGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCCGCCACTGCCTGTGCTTCATGAGGAAGA
HKR420774 RBdS051P14 pGCAP10 NM_000284.2  
GGTTATTACGACTCTGTCACGCCGCGGTGCGACTGAGGCGTGGCGTCTGCTGGGGCACCT
HKR442262 RBdS105K22 pGCAP10 NM_000284.2  
GGAAGGAGACTTGGGGGCACCCGCGTCGTGCCTCCTGGGTTGTGAGGAGTCGCCGCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl