Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02340

HP ID(1) HP02340
Gene ID(2) 7419
Gene Symbol finder VDAC3
Protein Name voltage-dependent anion channel 3
RefSeq NM_005662.5
Length of RefSeq (bp) 1458
Chromosome 8p11.2
Reference DDBJ accession
UniGene Hs.699301

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12G03 pKA1U5 GGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTCT
ARi05G12 pGCAP10 GGGAGCAGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGAT
ARiS085K09 pGCAP10 GAGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTC
RBb58E01 pGCAP1 GGAAGACCTTCAGCGTTGCCCTGGCGGAGCAGAGACAGGCCCTCGGGGTGGAGGTCTTTG
RBb70G01 pGCAP1 TCTACCACTAAGGGACCTTCAGCGTTGCCCTGGCGGAGCAGAGACAGGCCCTCGGGGTGG
RBd36H06 pGCAP10 GAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTCTAAGAT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl