Prev. |  KEGG KO K15041 > 

RIKEN DNA Bank Human Resource - VDAC3

Gene ID NCBI Gene 7419 |  KEGG hsa:7419
Gene Symbol VDAC3
Protein Name voltage dependent anion channel 3
Synonyms HD-VDAC3|VDAC-3
Featured content Parkinson disease - human
Featured content Huntington disease - human
Ortholog resource in our bank

  VDAC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX047934 IRAK119N22 pCMV-SPORT6 BC056870 NM_005662 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044947 ARe12G03 pKA1U5 NM_005662.5  
GGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTCT
HKR162156 ARi05G12 pGCAP10 NM_005662.5  
GGGAGCAGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGAT
HKR234249 ARiS085K09 pGCAP10 NM_005662.5  
GAGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTC
HKR343297 RBb58E01 pGCAP1 NM_005662.5  
GGAAGACCTTCAGCGTTGCCCTGGCGGAGCAGAGACAGGCCCTCGGGGTGGAGGTCTTTG
HKR348145 RBb70G01 pGCAP1 NM_005662.5  
TCTACCACTAAGGGACCTTCAGCGTTGCCCTGGCGGAGCAGAGACAGGCCCTCGGGGTGG
HKR374574 RBd36H06 pGCAP10 NM_005662.5  
GAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTCTAAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.07.20

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl