Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02285

HP ID(1) HP02285
Gene ID(2) 7936
Gene Symbol finder RDBP
Protein Name RD RNA binding protein
RefSeq NM_002904.5
Length of RefSeq (bp) 1568
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.423935

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS109E09 pGCAP10 TGGGTCATCNTTGTGAGCCCGCTATCAGCGGCCAGCGCGGGCGCGGCCGGAGACCGTGGG
RBd58F05 pGCAP10 GGTTGTGAGCCCGCTATCAGCGGCCAGCGCGGGCGCGGCCNGNNNNNGTGGGGCCCCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl