Prev. |  KEGG KO K15182 > 

RIKEN DNA Bank Human Resource - NELFE

Gene ID NCBI Gene 7936 |  KEGG hsa:7936
Gene Symbol NELFE
Protein Name negative elongation factor complex member E
Synonyms D6S45|NELF-E|RD|RDBP|RDP
Ortholog resource in our bank

  NELFE

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044300 IRAK110M12 pCMV-SPORT6 BC050617 -
HGY096995 IRAL042I03 pOTB7 BC025235 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243705 ARiS109E09 pGCAP10 NM_002904.5  
TGGGTCATCNTTGTGAGCCCGCTATCAGCGGCCAGCGCGGGCGCGGCCGGAGACCGTGGG
HKR383325 RBd58F05 pGCAP10 NM_002904.5  
GGTTGTGAGCCCGCTATCAGCGGCCAGCGCGGGCGCGGCCNGNNNNNGTGGGGCCCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl