Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02262

HP ID(1) HP02262
Gene ID(2) 7905
Gene Symbol finder REEP5
Protein Name receptor accessory protein 5
RefSeq NM_005669.4
Length of RefSeq (bp) 3116
Chromosome 5q22-q23
Reference DDBJ accession
UniGene Hs.429608

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe43B08 pKA1U5 ACTAGGAACAGCCCCGGGCGGCGAGACGGTCCCCGCCATGTCTGCGGCCATGAGGGAGAG
ARe56F11 pKA1U5 GCTGCCGCTGCTCCGCCGCAGTCGCCGCTCCANCCCTATACGAGCACTAGGAACAGCCCC
ARi50H10 pGCAP10 GAGTCGCCGCTCCAGTCTATCCGGCACTAGGAACAGCCCCGAGCGGCGAGACGGTCCCCG
ARiS013D13 pGCAP10 GGTCCCCGCCATGTCTGCGGCCATGAGGGAGAGGTTCGACCGGTTCCTGCACGAGAAGAA
ARiS109O10 pGCAP10 GACTAGGAACAGCCCCGAGCGGCGAGACGGTCCCCGCCATGTCTGCGGCCATGAGGGAGA
ARiS118O24 pGCAP10 GGCTGCTCCGCCGCAGTCGCCGCTCCAGTCTATCCGGCACTAGGAACAGCCCCGGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl