Prev. |  KEGG KO K17279 > 

RIKEN DNA Bank Human Resource - REEP5

Gene ID NCBI Gene 7905 |  KEGG hsa:7905
Gene Symbol REEP5
Protein Name receptor accessory protein 5
Synonyms C5orf18|D5S346|DP1|TB2|YOP1|Yip2e
Ortholog resources KEGG ortholog (KEGG orthology K17279) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056321 IRAK140N09 pCMV-SPORT6 BC065926 NM_005669 Full
HGY082407 IRAL006A07 pOTB7 BC000232 NM_005669 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE028641 W01A071K01 pENTR-TOPO IRAK140N09 BC065926 NM_005669  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057232 ARe43B08 pKA1U5 NM_005669.4  
ACTAGGAACAGCCCCGGGCGGCGAGACGGTCCCCGCCATGTCTGCGGCCATGAGGGAGAG
HKR062531 ARe56F11 pKA1U5 NM_005669.4  
GCTGCCGCTGCTCCGCCGCAGTCGCCGCTCCANCCCTATACGAGCACTAGGAACAGCCCC
HKR180178 ARi50H10 pGCAP10 NM_005669.4  
GAGTCGCCGCTCCAGTCTATCCGGCACTAGGAACAGCCCCGAGCGGCGAGACGGTCCCCG
HKR205285 ARiS013D13 pGCAP10 NM_005669.4  
GGTCCCCGCCATGTCTGCGGCCATGAGGGAGAGGTTCGACCGGTTCCTGCACGAGAAGAA
HKR243946 ARiS109O10 pGCAP10 NM_005669.4  
GACTAGGAACAGCCCCGAGCGGCGAGACGGTCCCCGCCATGTCTGCGGCCATGAGGGAGA
HKR247560 ARiS118O24 pGCAP10 NM_005669.4  
GGCTGCTCCGCCGCAGTCGCCGCTCCAGTCTATCCGGCACTAGGAACAGCCCCGGGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl