Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02181

HP ID(1) HP02181
Gene ID(2) 6047
Gene Symbol finder RNF4
Protein Name ring finger protein 4
RefSeq NM_002938.3
Length of RefSeq (bp) 2947
Chromosome 4p16.3
Reference DDBJ accession
UniGene Hs.66394

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi51C02 pGCAP10 GAGCGGAAGTGGGTTGCTGTTGAGGCGGCGGCATCTTTCTCGAGGAGCTCTCCTGGGCGG
ARiS088L03 pGCAP10 GGCTCTCCTGGGCGGCTGAAGAAGGAGCTTCTTCTCCGGAGTGCGCCGGCGGTGGCGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl