Prev. | 

RIKEN DNA Bank Human Resource - RNF4

Gene ID NCBI Gene 6047 |  KEGG hsa:6047
Gene Symbol RNF4
Protein Name ring finger protein 4
Synonyms RES4-26|SLX5|SNURF
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180450 ARi51C02 pGCAP10 NM_002938.3  
GAGCGGAAGTGGGTTGCTGTTGAGGCGGCGGCATCTTTCTCGAGGAGCTCTCCTGGGCGG
HKR235467 ARiS088L03 pGCAP10 NM_002938.3  
GGCTCTCCTGGGCGGCTGAAGAAGGAGCTTCTTCTCCGGAGTGCGCCGGCGGTGGCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl